The “leptin” gene makes a protein hormone that is important for regulating body

The “leptin” gene makes a protein hormone that is important for regulating body weight and metabolism
– studies have showed that mice without properly functioning leptin genes become morbidly obese.
Below is the DNA sequence of this leptin gene found in three different organisms (Mouse, Chimp, and
human); only the first 60 nucleotides of this gene are shown.
Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca
Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
1) Can you find any DNA gene similarities between these organisms? Which ones are the most
closely related?
2) How many differences are there between the human and chimpanzee sequences? How does the
mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)
3) Using this information how can DNA be used as evidence for evolution?
Watch the following video and then answer the questions:

(For Closed Captioning, Click on the cc Button)
4) What are vestigial structures?
5) What are some examples of these structures that we find in humans?
6) Can these structure show up again in an organism? Give an example (Hint: Think mutations)
7) How do these structure provide evidence for evolution?
what the video and answer the following
https://www.biointeractive.org/classroom-­‐resources/interactive-­‐assessment-­‐natural-­‐selection-­‐and-­‐
adaptation
8) Why did dark-colored rock pocket mice first appear in a population of light-colored rock pocket
mice?
9) Why do dark-colored rock pocket mice on dark lava flows have white bellies?
10) Mutations are always…
11) When dark-colored fur gives mice a 1% competitive advantage and 1% of the population begins
with dark fur, in about 1,000 years, 95% of the population will have dark fur. Which of the following
statements is true?
12) What does Dr. Carroll mean when he says “while mutation is random, natural selection is not”?
(Note: More than one answer is correct.)

Place this order or similar order and get an amazing discount. USE Discount code “GET20” for 20% discount