I need help with my assessment examination. I can only send the question when I start the assessment.
Category: Python
Use the terms “equivalent” and “identical” to distinguish between objects and va
Use the terms “equivalent” and “identical” to distinguish between objects and values. Illustrate the difference further using your own examples with Python lists and the “is” operator. Using your own Python list examples, explain how objects, references, and aliasing relate to one another.
Finally, create your own example of a function that modifies a list passed in as an argument. Hence, describe what your function does in terms of arguments, parameters, objects, and references. Create your own unique examples for this assignment. Do not copy them from the textbook or any other source.
The code and its output must be explained technically whenever asked. The explanation can be provided before or after the code, or in the form of code comments within the code. For any descriptive type question, Your answer must be at least 150 words.
End your discussion post with one question related to programming fundamentals learned in this unit from which your colleagues can formulate a response or generate further discussion. Remember to post your initial response as early as possible, preferably by Sunday evening, to allow time for you and your classmates to have a discussion.
When you use information from a learning resource, such as a textbook, be sure to credit your source and include the URL. Continue to practice using APA format for citations and references.
Example: Suppose that your program receives the following CSV with data for 4 pa
Example: Suppose that your program receives the following CSV with data for 4 patients…
PatientSample
11223344GGTCGGTAGACAGGTCGGTAGACAGGTCGGTAGACA
22233344TTTCAGAATTAGACTGTTTAGAGAAACTAGACCACA
33344455CCTAGTATGCACTATTGAAATGCTCGTTGATAGACA
55667788TGCTCGTTAGTGAACACTTAGACTGTTTAGGACCAC
You know from a prior Exploration that these DNA sequences convert to…
Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine,Glycine,Arginine,.,Threonine
Phenylalanine,Glutamine,Asparagine,.,Threonine,Valine,.,Arginine,Asparagine,.,Threonine,Threonine
Proline,Serine,Methionine,Histidine,Tyrosine,.,Asparagine,Alanine,Arginine,.,.,Threonine
Cysteine,Serine,Leucine,Valine,Asparagine,Threonine,.,Threonine,Valine,.,Aspartic acid,Histidine
These are amino acid sequences, and your program’s job is to let the user search for patients whose amino acid sequences contain a user-specified sequence.
The program would prompt the user to enter an amino acid sequence, and the user might enter “Methionine,Histidine,Tyrosine,.” Your program would then iterate through the CSV, convert each DNA sequence to an amino acid sequence, and check to see if each patient’s amino acid sequence contained the user’s specified string. In this case, the third patient’s sequence contains the user input. Therefore, in this case, your program would print “33344455” on a line by itself (because that’s the patient’s ID, according to the CSV). If other patients also matched, then your program also would print their numbers, as well, one per line.
As another example, suppose that the user entered “Threonine,Valine,.” In this case, the second and fourth patients, above, would match. In that case, the program would print two lines of output containing “22233344” and “55667788”, respectively.
You can succeed in this assignment by doing four things.
1. Use your text editor to create a .py file containing a Python program that prompts the user to enter an amino acid sequence. Then, the program should call input() a single time to read the specified sequence into a variable called query. For example, the user might enter “Methionine,Histidine,Tyrosine,.” as in the example above.
2. Extend your program by adding code that reads in a CSV named “samples.csv” containing two columns: Patient and Sample. After the header row, every row’s Patient column will contain an 8-digit number, and the corresponding Sample column will contain a DNA sequence consisting of letters in the set T, G, A and C. The program should iterate through the rows of the CSV. You can use this CSV to test that your program can successfully iterate through the rows.
3. Near the top of your program, write a function called translate(dna) that takes one parameter called dna containing a DNA sequence and returns a string of the corresponding amino acid sequence. Your function should break the DNA sequence into chunks of 3 characters, convert the 3-character chunk into an amino acid, and then concatenate the amino acid sequence together into a string with one comma between each amino acid. Refer to your prior Exploration on DNA to remind yourself of the conversion from DNA chunks (called codons) to amino acids. Verify that this function works by passing some of the example DNA strings, above, into your translate() function to verify that the function returns the right output for each.
4. Go back to the part of your program where it iterates through the rows of the CSV and, inside the loop, pass the specified DNA sequence of each patient to your translate(dna) function. For each patient, you now have the patient’s number, the patient’s DNA (as a string), and the patient’s corresponding amino acid sequence (as a string). Write a conditional to see if the patient’s amino acid sequence contains the string stored in query. (Hint: use the in and not in Operators. Or use the find() function.) If the patient’s amino acid sequence contains the query, then print out that patient’s number on a line.
This assignment is worth 70 points:
10 points for reading the amino acid sequence into a variable called query
10 points for creating a function called translate(dna) near the top of your program
10 points if the translate(dna) function gives the correct outputs for the following inputs:GGTCGGTAGACAGGTCGGTAGACAGGTCGGTAGACA
TTTCAGAATTAGACTGTTTAGAGAAACTAGACCACA
CCTAGTATGCACTATTGAAATGCTCGTTGATAGACA
TGCTCGTTAGTGAACACTTAGACTGTTTAGGACCAC
10 points if the translate(dna) function gives the correct output for one other DNA string that you don’t know in advance (it’s a secret)
10 points if your program handles the following queries correctly for this CSV:It prints one line containing “33344455” when given a query of “Methionine,Histidine,Tyrosine,.”
It prints two lines containing “22233344” and “55667788” when given the input “Threonine,Valine,.”
20 points if your program handles another different CSV with many rows, and a query that you don’t know in advance (it’s a secret)
I have the answers but I need the tutor to check and make different versions of
I have the answers but I need the tutor to check and make different versions of the codes but it should run the same results the tutor should be very good in python q1- Consider the message “Mississippi River.” What is the entropy of the message?
Here is a proposed coding scheme
Letter
Symbol
I
01
S
10
P
010
R
011
V
000
E
001
_ (space)
110
M
111
What is the entropy of the message coded using this system?
Is this system an optimum prefix-free code, explain why. If it is not, explain why and provide a table with an optimum code and give the entropy of the new code.
Upload a file with your response. Q2- Scenario Setup
Message (X): A binary message where ‘0’ and ‘1’ are equally likely. So,
p(X=0)=0.5 and p(X=1)=0.5.
Noisy Channel:
When ‘0’ is sent, there’s a p chance the receiver gets ‘0’ and a (1-p) chance the receiver gets ‘1’.
When ‘1’ is sent, there’s a 95% chance the receiver gets ‘1’ and a 5% chance the receiver gets ‘0’.
What value of p is needed to give a mutual information of 0.75 bits? Explain what a mutual information of 0.75 bits means.
q3- Odds of 2:1 mean that I wager $1 I get my $1 wager back plus $2. Even odds (1:1) means that a horse has a 50% chance of winning.
The Kelly fraction for a horse race is given by
f* = (bp-q) / b
Where:
f* = the optimal bet size as a percentage of your bankroll
b = the decimal odds offered by the bookmaker
p = the probability of winning
q = the probability of losing (1-p)
Find the Kelly fraction given the following conditions
Horse
Probability of Win
Odds
A
0.5
1
B
0.4
2
C
0.1
10
Simulate 10 races by generating a winner using the probabilities and making bets based on the Kelly fraction.
After each race report the result like this where X,Y,Z are the dollar amounts of the bets on each horse.
Bet made: Horse A $X, Horse B $Y, Horse C $Z Race 1 Winner: Horse B
Resulting bankroll: $109
Q4-Slides 44 and 45 of slide deck 10 detail the construction of G1, G2 and the taps used for each space vehicle.
The digital output is all 1’s and 0’s. However when transmitted with BPSK all of the 1’s become 1s and all of the 0’s become -1s. Generate the transmitted BPSK sequence of 1023 bits for space vehicle 20.
(The slides are provided in the attachment)
Exercise 11.1 Pick a stock. Get the historical data from Yahoo Finance and calcu
Exercise 11.1
Pick a stock. Get the historical data from Yahoo Finance and calculate the latest 20-day moving average of prices. Make connection to IB IPA system and buy the stock if its price is above moving average and short-sell it if the price is lower than the moving average. You don’t need to design any mechanism to implement short-selling. Just simply sell the stock!
Exercise 11.2
Repeat the steps in question 1, but get the historical data from IB APA system this time.
Exercise 11.3
Are there any differences between your findings in questions 1 and 2? If yes, explain!
Please choose MICROSOFT stock
In this unit, we explored the basic concepts of fundamental concepts of Iteratio
In this unit, we explored the basic concepts of fundamental concepts of Iterations and Strings in Python. Before completing this assignment, review the reading material listed below:
Think Python: How to think like a computer scientist Chapters 7 – Iterations (p. 63- 69)
Think Python: How to think like a computer scientist Chapters 8- Strings (p. 71- 79)
Please ensure that you review all examples presented in Chapters before you work on this assignment.
Write program to display your name and perform following operations on it: Display n characters from left. (Accept n as input from the user)
Count the number of vowels. Reverse it. The code and its output must be explained technically. The explanation can be provided before or after the code, or in the form of comments within the code. The descriptive part of your response must be at least 200 words.
If you use an informational source, be sure to identify the source and share the link to the source you used. This is a good time to start practicing some of what you learned about APA in UNIV 1001.
1. Use your text editor to create a .py file containing a Python program that pr
1. Use your text editor to create a .py file containing a Python program that prompts the user to enter an amino acid sequence. Then, the program should call input() a single time to read the specified sequence into a variable called query. For example, the user might enter “Methionine,Histidine,Tyrosine,.” as in the example above.
2. Extend your program by adding code that reads in a CSV named “samples.csv” containing two columns: Patient and Sample. After the header row, every row’s Patient column will contain an 8-digit number, and the corresponding Sample column will contain a DNA sequence consisting of letters in the set T, G, A and C. The program should iterate through the rows of the CSV. You can use this CSV to test that your program can successfully iterate through the rows.
3. Near the top of your program, write a function called translate(dna) that takes one parameter called dna containing a DNA sequence and returns a string of the corresponding amino acid sequence. Your function should break the DNA sequence into chunks of 3 characters, convert the 3-character chunk into an amino acid, and then concatenate the amino acid sequence together into a string with one comma between each amino acid. Refer to your prior Exploration on DNA to remind yourself of the conversion from DNA chunks (called codons) to amino acids. Verify that this function works by passing some of the example DNA strings, above, into your translate() function to verify that the function returns the right output for each.
4. Go back to the part of your program where it iterates through the rows of the CSV and, inside the loop, pass the specified DNA sequence of each patient to your translate(dna) function. For each patient, you now have the patient’s number, the patient’s DNA (as a string), and the patient’s corresponding amino acid sequence (as a string). Write a conditional to see if the patient’s amino acid sequence contains the string stored in query. (Hint: use the in and not in Operators. Or use the find() function.) If the patient’s amino acid sequence contains the query, then print out that patient’s number on a line.
10 points for reading the amino acid sequence into a variable called query
10 points for creating a function called translate(dna) near the top of your program
10 points if the translate(dna) function gives the correct outputs for the following inputs:GGTCGGTAGACAGGTCGGTAGACAGGTCGGTAGACA
TTTCAGAATTAGACTGTTTAGAGAAACTAGACCACA
CCTAGTATGCACTATTGAAATGCTCGTTGATAGACA
TGCTCGTTAGTGAACACTTAGACTGTTTAGGACCAC
10 points if the translate(dna) function gives the correct output for one other DNA string that you don’t know in advance (it’s a secret)
10 points if your program handles the following queries correctly for this CSV:It prints one line containing “33344455” when given a query of “Methionine,Histidine,Tyrosine,.”
It prints two lines containing “22233344” and “55667788” when given the input “Threonine,Valine,.”
20 points if your program handles another different CSV with many rows, and a query that you don’t know in advance (it’s a secret)
Use your text editor to create a .py file containing a Python program that conta
Use your text editor to create a .py file containing a Python program that contains a function called load_news_json(). This function should retrieve the JSON stored at the NPR news feed from the URL below and return the “items” list…
https://www.npr.org/feeds/1019/feed.json The JSON returned by this news feed has a format similar to the following:
Your load_news_json() function should load the JSON and return the “items” list. Typically, this list will contain somewhere between 5 and 25 dictionaries. So load_news_json() should be returning a list of dictionaries.
Your program should call your load_news_json() function, iterate through the items, and write them to a CSV file called “news.csv” This CSV should have only two columns: title and url. The first row of the CSV should contain the heading, with the word “title” in the first column, and the word “url” in the second column. Then, the title and url values, for each row, should come from the corresponding entries in the news item’s dictionary.
For example, the old article shown in the screenshot above has a title of “Authorities Dismantle Transnational Cybercrime Group” and a URL of “https://www.npr.org/2019/05/16/723983442/authorities-dismantle-transnational-cybercrime-group?utm_medium=JSONFeed&utm_campaign=technology” So these two values should appear in the row of the CSV corresponding to this article. Because there are at least 6 articles shown in the screenshot above, you can be sure that the CSV also will have at least 6 rows.
The goal of this assignment is to segment the iris region of an eye and convert
The goal of this assignment is to segment the iris region of an eye and convert it into a co-centricity invariant representation (from Cartesian to polar coordinates) of a nxm matrix.
Use all images in “eyes.zip” in the Files section. For each image:
1. Use (a) the Hough transform for circle detection (any Matlab/Python implementation you find), and (b) Daugman’s integrodifferential objective to calculate both boundaries of the iris (inner and outer)
2. Convert the iris region into a polar coordinates representation (as in the lecture slides). Submit:
Matlab/Python code with any additional external functions you used.
A screen recording of your execution, for each image, where you will show: (i) the hough transform results superimposed on the image; (ii) Daugman’s method results superimposed on the image, and (iii) the “unwrapped” iris.
Notes: 3 points for Hough transform, 5 points for Daugman’s method, 2 points for screen recording
IMPORTANT: You will need to use the drop down above the code, below, to select “
IMPORTANT: You will need to use the drop down above the code, below, to select “PA2.py” and paste your PA2 code in that file in order for your PA3 code to work.
For this assignment you will be provided with a function callf2(f,p,q) whose input is a function and its two arguments, and returns the value of the function applied to the arguments. You are also given a “main” to test your code.
Your task is to implement three functions: eval_tt_f2(f) and equivalent(tt1,tt2) and is_tautology(tt).
The function eval_tt_f2(f) will, given a two argument Boolean function f as input (one of the functions you created in PA2.py), return the truth table for f. Use the function make_tt_ins(n) function you implemented in PA2.py to create a list with the inputs for the truth table, and then use callf2 to append the truth value for f to each row. For example, evalttf2(iff) should return:
[[False, False, True], [False, True, False], [True, False, False], [True, True, True]]
The function equivalent(tt1,tt2) should return True if tt1 and tt2 are logically equivalent and False otherwise. For example, equivalent(eval_tt_f2(PA2.implies), eval_tt_f2(PA2.nqIMPnp))
should return True.+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++Her I have written the code but I am getting erros, please see the attached (feedback) picture. I want it to get it modify and get the full marks.