this is a Genetic scientific paper IMRAD Report and its ongoing report. for now (only introduction, method, and reference) is required. it’s in CSE style. please review ALL the files carefully. Try to refer to the (Actual Experiment miR-101.pdf), especially THE LAST page. You have to review ALL the files carefully.
please include this info:
Gene of interest: MOB4
Accession#: NM_199482
Function: Protein Coding, related to multiple diseases
Total mRNA length (coding sequence): 3802
Forward Primer(5′ – 3′): ACCCTGATTCCTTAGGTGGCT
Reverse Primer(5′ – 3′): TTCATCAAAGGATTCATCAGGCCA
97
TITLE: The title should be a concise description of your project and should include the name of your candidate gene, species, method used to investigate your question, (and eventually your main result). It should provide enough detail to allow someone interested in your topic to find your paper with a Google search. (Review the files)
INTRODUCTION: The Introduction should be approximately 1.5 pages long, and include background, question and hypothesis, prediction, and your scientific approach.(Review the files)
METHODS: The Methods section should be 1 – 1.5 pages long, double-spaced. Write the Methods section in the past tense, passive voice, as though you have already completed the whole experiment (Lab sessions 1.5, 2, and 3). Summarize the protocol for the miR lab experiments using full sentences in paragraph form (do not list materials). You followed the manufacturers instructions for any kits, so you do not need to include precise volumes for each step. Concentrations, if you know them, should be included (Review the files)
REFERENCE: remember ALWAYS cite from every files I’ve uploaded in a in-text citation and full citation as well in CES style. (review the files). use 2 primary sources.
finally: please review the rubric on pages 3-5 in (Guidance.pdf), and try to meet 5 points criteria as this is used for marking. be authentic, be professional, double check your grammar and spilling.
Report example is a good example but please note that it’s from a different experiment, plus it’s super lengthy. so it’s just to give you an idea. Do not put cover page, instead put the title on the same page as the introduction page.
Place this order or similar order and get an amazing discount. USE Discount code “GET20” for 20% discount